International  +32 (0) 2 732 56 88  +32 (0) 2 732 44 14
France  01 43 25 01 50  01 43 25 01 60
Italy  02 36 00 65 93  02 36 00 65 94
Japan  +81 78 386 0860  +81 78 306 0296
 
 
 
YSC1247 - Yeast TAP-Fusion Membrane Protein Subset
Product details
Product number YSC1247
Product name Yeast TAP-Fusion Membrane Protein Subset
Quantity each
Supplier Gentaur

Only available for Belgium

 

 

Product: Yeast TAP-Fusion ORF Strains

Catalog #: YSC1178

Product Description

The Yeast TAP-Fusion Library (scTAP) is comprised of 4,247 Open Reading

Frames (ORFs) tagged with a high-affinity epitope and expressed from its natural

chromosomal location. The tandem affinity purification (TAP) tag consists of a

calmodulin binding peptide, a TEV cleavage site and two IgG binding domains of

Staphylococcus aureus protein A. The scTAP strains are provided in individual tubes

containing stock cultures in YPD plus 15% glycerol. While the scTAP strains are

supplied in YPD media, SD complete or SD -HIS media can also be used.

Storage

The Yeast TAP-Fusion strains are shipped at ambient

temperature. The strains should be stored at -80oC.

Genotype of Saccharomyces cerevisiae used to construct scTAP strains

S288C: (ATCC 201388: MATa his3?1 leu2?0 met15?0 ura3?0)

Strain verification

PCR can be used to verify that the TAP-tag has been integrated into the

C-terminal coding region of each gene. The confirmation primers consist of a gene

specific primer and a cassette specific primer that will produce a short band of

approximately 500 base pairs in the mutant strains. Gene specific primer sequences

used to verify the strains are found in the Open Biosystems clone query ‘Details’ section.

Simply enter the ORF name into the query box and choose to search by “Yeast ORF ID”.

(See Figures 1, 2. & 3) The cassette specific primer (F2CHK) sequence is:

AACCCGGGGATCCGTCGACC . A complete PCR protocol is attached in the

Appendix.

Phone: 1-888-412-2225 FAX: 1-256-704-4849 support@openbiosystems.com

V11003 For Research Use Only

Figure 1: Open Biosystems Query

Figure 2: Open Biosystems Clone Results

Figure 3: Open Biosystems Strain Details Page

 

Making a stock culture

Once the strain has been streak-isolated and the identity of the strain has been

confirmed, we recommend making a stock of the pure culture. Inoculate the pure culture

in YPD broth and incubate for 48 hours at 30oC. Transfer 850µl of culture into a

polypropylene tube and add 150µl sterile glycerol to make a 15% glycerol freezing

solution. Vortex the culture to evenly mix the glycerol throughout the culture. The

culture can be stored indefinitely at -80oC.

Overview

To facilitate global protein analyses, Dr. Erin O’Shea and Dr. Jonathan

Weissman (UCSF) have created a Saccharomyces cerevisiae fusion library where each

ORF is tagged with a high-affinity epitope and expressed from its natural chromosomal

location. Through immunodetection of the common tag, a resource now exists that

provides a census of proteins expressed during log-phase growth and quantifies their

absolute levels. Characterization of this library revealed that ~80% of the proteome is

expressed during normal growth conditions. The abundance of proteins ranged from

fewer than 50 to more than 106 molecules/cell with many, including essential proteins

and most transcription factors, having levels not readily detectable by other proteomic

techniques, nor predictable by mRNA levels or codon bias measurements (Figures 4 & 5)1.

Figure 4: Protein Detection1

Figure 5: Protein Detection per Cell1

 

The Yeast Tap-Fusion Library allows the purification and selection of the entire yeast

proteome and associated components using two simple affinity selection steps in

tandem, enabling the development of a range of high-throughput functional assays. A

collection of ORF specific oligonucleotide primers was synthesized. Each primer pair

possessed shared 3’ ends that allowed for PCR amplification of a common insertion

cassette, as well as gene-specific 5’ ends that allowed for the precise introduction,

through homologous recombination, of the amplified insertion cassettes as a perfect inframe

fusion at the C-terminal end of the coding region of each gene (Figure 6)1.

Figure 6: Insertion of C-terminal TAP cassette1

The C-terminal TAP insertion cassette contains the coding region for a modified version

of the TAP (Tandem Affinity Purification) tag, which consists of a calmodulin binding

peptide, a TEV cleavage site and two IgG binding domains of Staphylococcus aureus

protein A, as well as a selectable marker. In total, successful integrants were obtained

for 98% of all ORFs annotated in the Saccharomyces Genome Database (as of April

2001), including 93% of all essential ORFs in haploid yeast.

Finding additional information for individual constructs

A valuable resource for locating relevant construct information is the Open

Biosystems Query (http://www.openbiosystems.com/query). Simply enter a Yeast ORF

ID or Gene Symbol into the query box, choose ‘Yeast ORF ID’ and click ‘GO’ (See

Figures 1, 2, & 3)

 

Useful websites

Séraphin Group TAP method

http://www-db.embl-heidelberg.de/jss/servlet/de.embl.bk.wwwTools.GroupLeftEMBL/ExternalInfo/seraphin/TAP.html

O’Shea Lab

http://www.ucsf.edu/ekolab/

Weismann Lab

http://www.ucsf.edu/jswlab/

Saccharomyces Genome Database

http://www.yeastgenome.org/

References

1. Ghaemmaghami, S. et al. Global analysis of protein expression in yeast. Nature

425, 737-741 (16 October 2003).

Additional literature

Gavin, A. C. et al. Functional organization of the yeast proteome by systematic analysis

of protein complexes. Nature 415, 141-7 (2002).

Rigaut, G. et al. A generic protein purification method for protein complex

characterization and proteome exploration. Nat Biotechnol 17, 1030-2 (1999).

Phone: 1-888-412-2225 FAX: 1-256-704-4849 support@openbiosystems.com

V11003 For Research Use Only

Appendix

Liquid Culture PCR

1. Grow cells to stationary phase.

2. Transfer 200µl of culture to a PCR tube.

3. Spin down cells and discard supernatant by aspiration.

4. Suspend cells in 20µl of 0.2% SDS solution.

5. Boil cell suspension at 99°C for 10 min using PCR machine.

6. Add 1.5 (0.6) µl of boiled cell suspension to the PCR reaction mixture of final 50 (20)µl

volume:

40.5 (16.2) µl H2O

5 (2) µl 10x Taq buffer

1.5 (0.6) µl 2 mM each dNTP

0.5 (0.2) µl 50 µM forward primer

0.5 (0.2) µl 50 µM reverse primer

0.5 (0.2) µl 5 U/µl Taq polymerase

0.1 (0.04) µl 10 mg/ml RNase

* For library construction

(1) 0.6 µl boiled cells

+

(2) 2 µl 5 µM CHK primer

+ (x1300)

(3) 14.5 ul H2O :18.85 ml

2 µl 10x Taq buffer :2.6 ml

0.5 µl 2 mM each dNTP :0.65 ml

0.2 µl 50 µM F2CHK :260 µl

0.2 µl 5 U/µl Taq pol. :260 µl

0.04 µl 10 mg/ml RNase :50 µl

 

 

 

Price
EUR3.081
USD3.851
GBP2.468
DKK22.957
JPY506.997
PLZ10.503
SEK28.795
NOK24.454
Buy or request info
 
Selected products

Europe - Gentaur Molecular Products bvba, Av. de l' Arme 68, B-1040 Brussels Tel:  +32 2 732 56 88 Fax. : +32 2 732 44 14
France 9, rue Lagrange 75005 Paris Tel:  01 43 25 01 50 Fax:  01 43 25 01 60
Italy Tel:  02 36 00 65 93 Fax: 02 36 00 65 94
Japan, Minaatojimaminami-manchi, Chuo-ku, Kobe 065-0047 Tel: +81 78 386 0860Fax: +81 78 306 0296