Only available for Belgium
Product: Yeast TAP-Fusion ORF Strains
Catalog #: YSC1178
Product Description
The Yeast TAP-Fusion Library (scTAP) is comprised of 4,247 Open Reading
Frames (ORFs) tagged with a high-affinity epitope and expressed from its natural
chromosomal location. The tandem affinity purification (TAP) tag consists of a
calmodulin binding peptide, a TEV cleavage site and two IgG binding domains of
Staphylococcus aureus protein A. The scTAP strains are provided in individual tubes
containing stock cultures in YPD plus 15% glycerol. While the scTAP strains are
supplied in YPD media, SD complete or SD -HIS media can also be used.
Storage
The Yeast TAP-Fusion strains are shipped at ambient
temperature. The strains should be stored at -80 oC.
Genotype of Saccharomyces cerevisiae used to construct scTAP strains
S288C: (ATCC 201388: MATa his3 ?1 leu2?0 met15?0 ura3?0)
Strain verification
PCR can be used to verify that the TAP-tag has been integrated into the
C-terminal coding region of each gene. The confirmation primers consist of a gene
specific primer and a cassette specific primer that will produce a short band of
approximately 500 base pairs in the mutant strains. Gene specific primer sequences
used to verify the strains are found in the Open Biosystems clone query ‘Details’ section.
Simply enter the ORF name into the query box and choose to search by “Yeast ORF ID”.
(See Figures 1, 2. & 3) The cassette specific primer (F2CHK) sequence is:
AACCCGGGGATCCGTCGACC . A complete PCR protocol is attached in the
Appendix.
Phone: 1-888-412-2225 FAX: 1-256-704-4849 support@openbiosystems.com
V11003 For Research Use Only
Figure 1: Open Biosystems Query
Figure 2: Open Biosystems Clone Results
Figure 3: Open Biosystems Strain Details Page
Making a stock culture
Once the strain has been streak-isolated and the identity of the strain has been
confirmed, we recommend making a stock of the pure culture. Inoculate the pure culture
in YPD broth and incubate for 48 hours at 30 oC. Transfer 850µl of culture into a
polypropylene tube and add 150µl sterile glycerol to make a 15% glycerol freezing
solution. Vortex the culture to evenly mix the glycerol throughout the culture. The
culture can be stored indefinitely at -80 oC.
Overview
To facilitate global protein analyses, Dr. Erin O’Shea and Dr. Jonathan
Weissman (UCSF) have created a Saccharomyces cerevisiae fusion library where each
ORF is tagged with a high-affinity epitope and expressed from its natural chromosomal
location. Through immunodetection of the common tag, a resource now exists that
provides a census of proteins expressed during log-phase growth and quantifies their
absolute levels. Characterization of this library revealed that ~80% of the proteome is
expressed during normal growth conditions. The abundance of proteins ranged from
fewer than 50 to more than 10 6 molecules/cell with many, including essential proteins
and most transcription factors, having levels not readily detectable by other proteomic
techniques, nor predictable by mRNA levels or codon bias measurements (Figures 4 & 5)1.
Figure 4: Protein Detection 1
Figure 5: Protein Detection per Cell 1
The Yeast Tap-Fusion Library allows the purification and selection of the entire yeast
proteome and associated components using two simple affinity selection steps in
tandem, enabling the development of a range of high-throughput functional assays. A
collection of ORF specific oligonucleotide primers was synthesized. Each primer pair
possessed shared 3’ ends that allowed for PCR amplification of a common insertion
cassette, as well as gene-specific 5’ ends that allowed for the precise introduction,
through homologous recombination, of the amplified insertion cassettes as a perfect inframe
fusion at the C-terminal end of the coding region of each gene (Figure 6)1.
Figure 6: Insertion of C-terminal TAP cassette 1
The C-terminal TAP insertion cassette contains the coding region for a modified version
of the TAP (Tandem Affinity Purification) tag, which consists of a calmodulin binding
peptide, a TEV cleavage site and two IgG binding domains of Staphylococcus aureus
protein A, as well as a selectable marker. In total, successful integrants were obtained
for 98% of all ORFs annotated in the Saccharomyces Genome Database (as of April
2001), including 93% of all essential ORFs in haploid yeast.
Finding additional information for individual constructs
A valuable resource for locating relevant construct information is the Open
Biosystems Query ( http://www.openbiosystems.com/query). Simply enter a Yeast ORF
ID or Gene Symbol into the query box, choose ‘Yeast ORF ID’ and click ‘GO’ (See
Figures 1, 2, & 3)
Useful websites
Séraphin Group TAP method
http://www-db.embl-heidelberg.de/jss/servlet/de.embl.bk.wwwTools.GroupLeftEMBL/ExternalInfo/seraphin/TAP.html
O’Shea Lab
http://www.ucsf.edu/ekolab/
Weismann Lab
http://www.ucsf.edu/jswlab/
Saccharomyces Genome Database
http://www.yeastgenome.org/
References
1. Ghaemmaghami, S. et al. Global analysis of protein expression in yeast. Nature
425, 737-741 (16 October 2003) .
Additional literature
Gavin, A. C. et al. Functional organization of the yeast proteome by systematic analysis
of protein complexes. Nature 415, 141-7 (2002).
Rigaut, G. et al. A generic protein purification method for protein complex
characterization and proteome exploration. Nat Biotechnol 17, 1030-2 (1999).
Phone: 1-888-412-2225 FAX: 1-256-704-4849 support@openbiosystems.com
V11003 For Research Use Only
Appendix
Liquid Culture PCR
1. Grow cells to stationary phase.
2. Transfer 200 µl of culture to a PCR tube.
3. Spin down cells and discard supernatant by aspiration.
4. Suspend cells in 20 µl of 0.2% SDS solution.
5. Boil cell suspension at 99 °C for 10 min using PCR machine.
6. Add 1.5 (0.6) µl of boiled cell suspension to the PCR reaction mixture of final 50 (20)µl
volume:
40.5 (16.2) µl H2O
5 (2) µl 10x Taq buffer
1.5 (0.6) µl 2 mM each dNTP
0.5 (0.2) µl 50 µM forward primer
0.5 (0.2) µl 50 µM reverse primer
0.5 (0.2) µl 5 U/µl Taq polymerase
0.1 (0.04) µl 10 mg/ml RNase
* For library construction
(1) 0.6 µl boiled cells
+
(2) 2 µl 5 µM CHK primer
+ (x1300)
(3) 14.5 u l H2O :18.85 ml
2 µl 10x Taq buffer :2.6 ml
0.5 µl 2 mM each dNTP :0.65 ml
0.2 µl 50 µM F2CHK :260 µl
0.2 µl 5 U/µl Taq pol. :260 µl
0.04 µl 10 mg/ml RNase :50 µl
|